Human MOB1B / MOBKL1A Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC038112

RefSeq ORF Size

651bp

Gene Synonym

MATS2, MOB4A, MOBKL1A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human MOB kinase activator 1B Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

MST1 and MST2 are the mammalian Ste20-related protein kinases most closely related to Drosophila Hippo, a major regulator of cell proliferation and survival during development. Overexpression of MST1 or MST2 in mammalian cells is proapototic. MST1 and MST2 activity increases during mitosis, especially in nocodazole-arrested mitotic cells, where these kinases exhibit both an increase in both abundance and activation. MST1 and MST2 also can be activated nonphysiologically by okadaic acid or H2O2. The MOB1B and MOBKL1B polypeptides, homologs of the Drosophila MATS polypeptide, are identified as preferred MST1/MST2 substrates in vitro and are phosphorylated in cells in an MST1/MST2-dependent manner in mitosis and in response to okadaic acid or H2O2. MST1/MST2-catalyzed MOB1B/MOBKL1B phosphorylation alters the ability of MOB1B/MOBKL1B to bind and regulate downstream targets such as the NDR-family protein kinases. Thus, MOB1B/MOBKL1B phosphorylation in cells promotes MOB1B/MOBKL1B binding to the LATS1 kinase and enables H2O2-stimulated LATS1 activation loop phosphorylation. Most importantly, replacement of endogenous MOB1B/MOBKL1B by a nonphosphorylatable mutant is sufficient to accelerate cell proliferation substantially by speeding progression through G1/S as well as mitotic exit.

References

Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.

Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.

Devroe E, et al. (2004) Human Mob proteins regulate the NDR1 and NDR2 serine-threonine kinases. J Biol Chem. 279(23):24444-51.

Praskova M, et al. (2008) MOB1B/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol. 18(5):311-21.

Catalog Number:HGE911-NY