Human MOB1B / MOBKL1A Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGE911-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
651bp
Gene Synonym
MATS2, MOB4A, MOBKL1A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human MOB kinase activator 1B Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
MST1 and MST2 are the mammalian Ste20-related protein kinases most closely related to Drosophila Hippo, a major regulator of cell proliferation and survival during development. Overexpression of MST1 or MST2 in mammalian cells is proapototic. MST1 and MST2 activity increases during mitosis, especially in nocodazole-arrested mitotic cells, where these kinases exhibit both an increase in both abundance and activation. MST1 and MST2 also can be activated nonphysiologically by okadaic acid or H2O2. The MOB1B and MOBKL1B polypeptides, homologs of the Drosophila MATS polypeptide, are identified as preferred MST1/MST2 substrates in vitro and are phosphorylated in cells in an MST1/MST2-dependent manner in mitosis and in response to okadaic acid or H2O2. MST1/MST2-catalyzed MOB1B/MOBKL1B phosphorylation alters the ability of MOB1B/MOBKL1B to bind and regulate downstream targets such as the NDR-family protein kinases. Thus, MOB1B/MOBKL1B phosphorylation in cells promotes MOB1B/MOBKL1B binding to the LATS1 kinase and enables H2O2-stimulated LATS1 activation loop phosphorylation. Most importantly, replacement of endogenous MOB1B/MOBKL1B by a nonphosphorylatable mutant is sufficient to accelerate cell proliferation substantially by speeding progression through G1/S as well as mitotic exit.
References
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Devroe E, et al. (2004) Human Mob proteins regulate the NDR1 and NDR2 serine-threonine kinases. J Biol Chem. 279(23):24444-51.
  • Praskova M, et al. (2008) MOB1B/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol. 18(5):311-21.
  • TOP