Human MICA Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC016929

RefSeq ORF Size

1176 bp

Gene Synonym

MIC-A, PERB11.1, MICA

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human MHC class I polypeptide-related sequence A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

KpnI + XbaI(6kb+1.18kb)

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

MHC class I chain-related molecules A (MICA) is one of the genes in the HLA class I region, which belongs to MHC class I family. It is the member of the non-classical class I family that displays the greatest degree of polymorphism. The MICA protein product is expressed on the cell surface, although unlike canonical class I molecules does not seem to associate with beta-2-microglobulin. It is thought that MICA functions as a stress-induced antigen that is broadly recognized by NK cells, NKT cells, and most of the subtypes of T cells. The Natural killer group 2D (NKG2D), a C-type lectin-like activating immunoreceptor, is a receptor of MICA, which was detected on most gammadelta T cells, CD8+ alphabeta T cells, and natural killer (NK) cells. Effector cells from all these subsets could be stimulated by ligation of NKG2D. Engagement of NKG2D activated cytolytic responses of gammadelta T cells and NK cells against transfectants and epithelial tumor cells expressing MICA. The MICA system is a novel, avidin-free immunohistochemical detection system that provides a significant increase in sensitivity compared to traditional immunodetection systems.

References

Choy MK, et al. (2010) MICA polymorphism: biology and importance in immunity and disease. Trends Mol Med. 16(3): 97-106.

Li J, et al. (2005) Distinct pattern of human Vdelta1 gammadelta T cells recognizing MICA. Cell Mol Immunol. 2(4): 253-8.

Mangham DC, et al. (2000) MICA-a highly sensitive and avidin-free immunohistochemical detection system. Adv Anat Pathol. 7(6): 360-4.

Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428): 727-9.

Groh V, et al. (1998) Recognition of stress-induced MHC molecules by intestinal epithelial gammadelta T cells. Science. 279: 1737-40.

Catalog Number:HGE843-NM