Human MICA Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:HGE843-CH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Gene Synonym
MIC-A, PERB11.1, MICA
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human MHC class I polypeptide-related sequence A Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
KpnI + XbaI(6kb+1.18kb)
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
MHC class I chain-related molecules A (MICA) is one of the genes in the HLA class I region, which belongs to MHC class I family. It is the member of the non-classical class I family that displays the greatest degree of polymorphism. The MICA protein product is expressed on the cell surface, although unlike canonical class I molecules does not seem to associate with beta-2-microglobulin. It is thought that MICA functions as a stress-induced antigen that is broadly recognized by NK cells, NKT cells, and most of the subtypes of T cells. The Natural killer group 2D (NKG2D), a C-type lectin-like activating immunoreceptor, is a receptor of MICA, which was detected on most gammadelta T cells, CD8+ alphabeta T cells, and natural killer (NK) cells. Effector cells from all these subsets could be stimulated by ligation of NKG2D. Engagement of NKG2D activated cytolytic responses of gammadelta T cells and NK cells against transfectants and epithelial tumor cells expressing MICA. The MICA system is a novel, avidin-free immunohistochemical detection system that provides a significant increase in sensitivity compared to traditional immunodetection systems.
References
  • Choy MK, et al. (2010) MICA polymorphism: biology and importance in immunity and disease. Trends Mol Med. 16(3): 97-106.
  • Li J, et al. (2005) Distinct pattern of human Vdelta1 gammadelta T cells recognizing MICA. Cell Mol Immunol. 2(4): 253-8.
  • Mangham DC, et al. (2000) MICA-a highly sensitive and avidin-free immunohistochemical detection system. Adv Anat Pathol. 7(6): 360-4.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428): 727-9.
  • Groh V, et al. (1998) Recognition of stress-induced MHC molecules by intestinal epithelial gammadelta T cells. Science. 279: 1737-40.
  • TOP