Human Mesothelin/MSLN Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGE794-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1854 bp
Gene Synonym
Mesothelin,MPF,SMRP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mesothelin Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
HindIII + XbaI(6kb+1.85kb)
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Megakaryocyte potentiating factor belongs to the mesothelin family. This family is comprised by several mammalian pre-pro-megakaryocyte potentiating factor precursor (MPF) or mesothelin proteins. Mesothelin is a glycosylphosphatidylinositol-linked glycoprotein highly expressed in mesothelial cells, mesotheliomas, and ovarian cancer, but the biological function of the protein is not known. Megakaryocyte potentiating factor is highly expressed in mesotheliomas, ovarian cancers, and some squamous cell carcinomas (at protein level). It interacts with MUC16 and potentiates megakaryocyte colony formation in vitro. Megakaryocyte potentiating factor is secreted by several mesothelioma cell lines and is frequently elevated in the blood of patients with mesothelioma. Measurement of this protein may be useful in following the response of mesothelioma to treatment.
References
  • Chang MC, et al. (2012) Mesothelin enhances invasion of ovarian cancer by inducing MMP-7 through MAPK/ERK and JNK pathways. Biochem J. 442 (2): 293-302.
  • Nelson HH, et al. (2011) The relationship between tumor MSLN methylation and serum mesothelin (SMRP) in mesothelioma. Epigenetics. 6 (8): 1029-34.
  • Bournet B, et al. (2012) Gene expression signature of advanced pancreatic ductal adenocarcinoma using low density array on endoscopic ultrasound-guided fine needle aspiration samples. Pancreatology. 12 (1): 27-34.
  • TOP