Human Mesothelin/MSLN Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGE794-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1854 bp
Gene Synonym
Mesothelin,MPF,SMRP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mesothelin Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
HindIII + XbaI(6kb+1.85kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Megakaryocyte potentiating factor belongs to the mesothelin family. This family is comprised by several mammalian pre-pro-megakaryocyte potentiating factor precursor (MPF) or mesothelin proteins. Mesothelin is a glycosylphosphatidylinositol-linked glycoprotein highly expressed in mesothelial cells, mesotheliomas, and ovarian cancer, but the biological function of the protein is not known. Megakaryocyte potentiating factor is highly expressed in mesotheliomas, ovarian cancers, and some squamous cell carcinomas (at protein level). It interacts with MUC16 and potentiates megakaryocyte colony formation in vitro. Megakaryocyte potentiating factor is secreted by several mesothelioma cell lines and is frequently elevated in the blood of patients with mesothelioma. Measurement of this protein may be useful in following the response of mesothelioma to treatment.
References
  • Chang MC, et al. (2012) Mesothelin enhances invasion of ovarian cancer by inducing MMP-7 through MAPK/ERK and JNK pathways. Biochem J. 442 (2): 293-302.
  • Nelson HH, et al. (2011) The relationship between tumor MSLN methylation and serum mesothelin (SMRP) in mesothelioma. Epigenetics. 6 (8): 1029-34.
  • Bournet B, et al. (2012) Gene expression signature of advanced pancreatic ductal adenocarcinoma using low density array on endoscopic ultrasound-guided fine needle aspiration samples. Pancreatology. 12 (1): 27-34.
  • TOP