Human MARK3/C-TAK1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC024773

RefSeq ORF Size

2190bp

Gene Synonym

KP78, CTAK1, PAR1A, Par-1a, MARK3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human MAP/microtubule affinity-regulating kinase 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

MAP / microtubule affinity-regulating kinase 3, also known as C-TAK1, cTAK1, Cdc25C-associated protein kinase 1, ELKL motif kinase 2, Protein kinase STK10, Ser/Thr protein kinase PAR-1, Serine/threonine-protein kinase p78, MARK3, CTAK1 and EMK2, is a ubiquitous expressed protein which belongs to the protein kinase superfamily, CAMK Ser / Thr protein kinase family and MARK subfamily. MARK3 contains one KA1 (kinase-associated) domain, one protein kinase domain and one UBA domain. The Par-1 / MARK protein kinases play a pivotal role in establishing cellular polarity. This family of kinases contains a unique domain architecture, in which a ubiquitin-associated (UBA) domain is located C-terminal to the kinase domain. MARKs / PAR-1 are common regulators of cell polarity that are conserved from nematode to human. All of these kinases have a highly conserved C-terminal domain, which is termed the kinase-associated domain 1 (KA1).

References

Kato,T. et al., 2001, Neoplasia.3 (1):4-9.

Tochio,N. et al., 2006, Protein Sci. 15 (11):2534-43.

Murphy,J.M. et al., 2007, Proc Natl Acad Sci USA.104 (36):14336-41.

de Leng,W.W. et al., 2007,Clin Genet. 72 (6):568-73.

Chia,C.Y. et al., 2010, IUBMB Life. 62 (3):200-3.

Catalog Number:HGE695-CY