Human MARK3/C-TAK1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGE695-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2190bp
Gene Synonym
KP78, CTAK1, PAR1A, Par-1a, MARK3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human MAP/microtubule affinity-regulating kinase 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
MAP / microtubule affinity-regulating kinase 3, also known as C-TAK1, cTAK1, Cdc25C-associated protein kinase 1, ELKL motif kinase 2, Protein kinase STK10, Ser/Thr protein kinase PAR-1, Serine/threonine-protein kinase p78, MARK3, CTAK1 and EMK2, is a ubiquitous expressed protein which belongs to the protein kinase superfamily, CAMK Ser / Thr protein kinase family and MARK subfamily. MARK3 contains one KA1 (kinase-associated) domain, one protein kinase domain and one UBA domain. The Par-1 / MARK protein kinases play a pivotal role in establishing cellular polarity. This family of kinases contains a unique domain architecture, in which a ubiquitin-associated (UBA) domain is located C-terminal to the kinase domain. MARKs / PAR-1 are common regulators of cell polarity that are conserved from nematode to human. All of these kinases have a highly conserved C-terminal domain, which is termed the kinase-associated domain 1 (KA1).
References
  • Kato,T. et al., 2001, Neoplasia.3 (1):4-9.
  • Tochio,N. et al., 2006, Protein Sci. 15 (11):2534-43.
  • Murphy,J.M. et al., 2007, Proc Natl Acad Sci USA.104 (36):14336-41.
  • de Leng,W.W. et al., 2007,Clin Genet. 72 (6):568-73.
  • Chia,C.Y. et al., 2010, IUBMB Life. 62 (3):200-3.
  • TOP