Human MAD2L1/MAD2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_002358.3

RefSeq ORF Size

618bp

Gene Synonym

MAD2; HSMAD2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human MAD2 mitotic arrest deficient-like 1 (yeast) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Mitotic spindle assembly checkpoint protein MAD2A, also known as HsMAD2, Mitotic arrest deficient 2-like protein 1, MAD2-like protein 1, MAD2L1 and MAD2, is a nucleus and cytoplasm protein which belongs to the MAD2 family. MAD2L1 is a component of the spindle-assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. MAD2L1 is required for the execution of the mitotic checkpoint which monitors the process of kinetochore-spindle attachment and inhibits the activity of the anaphase promoting complex by sequestering CDC20 until all chromosomes are aligned at the metaphase plate. MAD2L1 has two highly different native conformations, an inactive open conformation that cannot bind CDC20 and that predominates in cytosolic monomers, and an active closed conformation. MAD2L1 in the closed conformation preferentially dimerizes with another molecule in the open conformation, but can also form a dimer with a molecule in the closed conformation. Formation of a heterotetrameric core complex containing two molecules of MAD1L1 and of MAD2L1 in the closed conformation promotes binding of another molecule of MAD2L1 in the open conformation and the conversion of the open to the closed form, and thereby promotes interaction with CDC20.

References

Luo X., et al., 2000, Nat. Struct. Biol. 7:224-229.

Sironi L., et al., 2002, EMBO J. 21:2496-2506.

Mapelli M., et al., 2007, Cell 131:730-743.

Ho C.-Y., et al., 2008, J. Cell. Biochem. 105:835-846.

Skinner J.J., et al., 2008, J. Cell Biol. 183:761-768.

Catalog Number:HGE630-NM