Human MAD2L1/MAD2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_002358.3

RefSeq ORF Size

618bp

Gene Synonym

MAD2; HSMAD2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human MAD2 mitotic arrest deficient-like 1 (yeast) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Mitotic spindle assembly checkpoint protein MAD2A, also known as HsMAD2, Mitotic arrest deficient 2-like protein 1, MAD2-like protein 1, MAD2L1 and MAD2, is a nucleus and cytoplasm protein which belongs to the MAD2 family. MAD2L1 is a component of the spindle-assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. MAD2L1 is required for the execution of the mitotic checkpoint which monitors the process of kinetochore-spindle attachment and inhibits the activity of the anaphase promoting complex by sequestering CDC20 until all chromosomes are aligned at the metaphase plate. MAD2L1 has two highly different native conformations, an inactive open conformation that cannot bind CDC20 and that predominates in cytosolic monomers, and an active closed conformation. MAD2L1 in the closed conformation preferentially dimerizes with another molecule in the open conformation, but can also form a dimer with a molecule in the closed conformation. Formation of a heterotetrameric core complex containing two molecules of MAD1L1 and of MAD2L1 in the closed conformation promotes binding of another molecule of MAD2L1 in the open conformation and the conversion of the open to the closed form, and thereby promotes interaction with CDC20.

References

Luo X., et al., 2000, Nat. Struct. Biol. 7:224-229.

Sironi L., et al., 2002, EMBO J. 21:2496-2506.

Mapelli M., et al., 2007, Cell 131:730-743.

Ho C.-Y., et al., 2008, J. Cell. Biochem. 105:835-846.

Skinner J.J., et al., 2008, J. Cell Biol. 183:761-768.

Catalog Number:HGE630-CY