Human LTC4S Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGE585-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
453bp
Gene Synonym
MGC33147, LTC4S
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human leukotriene C4 synthase Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Leukotriene C4 synthase, also known as LTC4 synthase, Leukotriene-C(4) synthase, and LTC4S, is a multi-pass membrane protein which belongs to the MAPEG family. LTC4S is detected in lung, platelets and the myelogenous leukemia cell line KG-1 (at protein level). LTC4S activity is present in eosinophils, basophils, mast cells, certain phagocytic mononuclear cells, endothelial cells, vascular smooth muscle cells and platelets. LTC4S is essential for the production of cysteinyl leukotrienes (Cys-LT), critical mediators in asthma. Mutagenic analysis of the conjugation function of human LTC4S has identified R51 and Y93 as critical for acid and base catalysis of LTA4 and reduced glutathione, respectively. A comparison across species for proteins that possess LTC4S activity reveals conservation of both of these residues, whereas R51 is absent in the FLAP molecules. Thus, within the glutathione S-transferase superfamily of genes, alignment of specific residues allows the separation of LTC4S family members from their most structurally similar counterparts, the FLAP molecules. Defects in LTC4S are the cause of leukotriene C4 synthase deficiency (LTC4 synthase deficiency). LTC4 synthase deficiency is a fatal neurometabolic developmental disorder. It is associated with muscular hypotonia, psychomotor retardation, failure to thrive, and microcephaly.
References
  • Gupta, N. et al., 1999, FEBS Lett. 449 (1): 66-70.
  • Penrose, JF. et al., 1999, Allergy Asthma Proc. 20 (6): 353-60.
  • Sayers, I. et al., 2003, Thorax. 58 (5): 417-24.
  • Schröder, O. et al., 2005, Cell Mol Life Sci. 62 (1): 87-94.
  • TOP