Human LTC4S Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_145867.1

RefSeq ORF Size

453bp

Gene Synonym

MGC33147, LTC4S

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human leukotriene C4 synthase Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Leukotriene C4 synthase, also known as LTC4 synthase, Leukotriene-C(4) synthase, and LTC4S, is a multi-pass membrane protein which belongs to the MAPEG family. LTC4S is detected in lung, platelets and the myelogenous leukemia cell line KG-1 (at protein level). LTC4S activity is present in eosinophils, basophils, mast cells, certain phagocytic mononuclear cells, endothelial cells, vascular smooth muscle cells and platelets. LTC4S is essential for the production of cysteinyl leukotrienes (Cys-LT), critical mediators in asthma. Mutagenic analysis of the conjugation function of human LTC4S has identified R51 and Y93 as critical for acid and base catalysis of LTA4 and reduced glutathione, respectively. A comparison across species for proteins that possess LTC4S activity reveals conservation of both of these residues, whereas R51 is absent in the FLAP molecules. Thus, within the glutathione S-transferase superfamily of genes, alignment of specific residues allows the separation of LTC4S family members from their most structurally similar counterparts, the FLAP molecules. Defects in LTC4S are the cause of leukotriene C4 synthase deficiency (LTC4 synthase deficiency). LTC4 synthase deficiency is a fatal neurometabolic developmental disorder. It is associated with muscular hypotonia, psychomotor retardation, failure to thrive, and microcephaly.

References

Gupta, N. et al., 1999, FEBS Lett. 449 (1): 66-70.

Penrose, JF. et al., 1999, Allergy Asthma Proc. 20 (6): 353-60.

Sayers, I. et al., 2003, Thorax. 58 (5): 417-24.

Schröder, O. et al., 2005, Cell Mol Life Sci. 62 (1): 87-94.

Catalog Number:HGE585-NO