Human LSM1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGE570-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
402bp
Gene Synonym
CASM, YJL124C, LSM1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
LSM1 is a Sm-like protein. Sm-like proteins can be detected in a variety of organisms based on sequence homology with the Sm protein family. Sm-like proteins include the Sm sequence motif, which consists of two regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM1 has a role in replication-dependent histone mRNA degradation and binds specifically to the 3''-terminal U-tract of U6 snRNA. LSM1 also facilitates RNA protein interactions and structural modifications which are required during ribosomal subunit assembly.
References
  • Shimizu Y, et al. (1997) Lineage- and differentiation stage-specific expression of LSM-1 (LPAP), a possible substrate for CD45, in human hematopoietic cells. Am J Hematol. 54(1):1=11.
  • Graber MW, et al. (1997) CaSm: an Sm-like protein that contributes to the transformed state in cancer cells. Cancer Res. 57(14):2961-5.
  • Séraphin B, et al. (1999) Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18(12):3451-62.
  • TOP