Human LSM1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGE570-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
402bp
Gene Synonym
CASM, YJL124C, LSM1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
LSM1 is a Sm-like protein. Sm-like proteins can be detected in a variety of organisms based on sequence homology with the Sm protein family. Sm-like proteins include the Sm sequence motif, which consists of two regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM1 has a role in replication-dependent histone mRNA degradation and binds specifically to the 3''-terminal U-tract of U6 snRNA. LSM1 also facilitates RNA protein interactions and structural modifications which are required during ribosomal subunit assembly.
References
  • Shimizu Y, et al. (1997) Lineage- and differentiation stage-specific expression of LSM-1 (LPAP), a possible substrate for CD45, in human hematopoietic cells. Am J Hematol. 54(1):1=11.
  • Graber MW, et al. (1997) CaSm: an Sm-like protein that contributes to the transformed state in cancer cells. Cancer Res. 57(14):2961-5.
  • Séraphin B, et al. (1999) Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18(12):3451-62.
  • TOP