Human LSAMP Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGE567-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1017bp
Gene Synonym
LAMP, IGLON3, FLJ34254, FLJ35396, FLJ37216, FLJ54658, LSAMP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human limbic system-associated membrane protein Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The limbic system-associated membrane protein (LAMP) is a cell surface glycoprotein expressed by cortical and subcortical regions of the mammalian CNS that comprise or receive direct projections from limbic system structures. The 64-68-kDa glycoprotein limbic system-associated membrane protein (LsAMP) is expressed on the surface of somata and proximal dendrites of neurons. These areas perform cognitive and autonomic functions, also learning and memory. The functional analysis indicates that LsAMP acts as a selective adhesion molecule, serving as a guidance cue for specific patterns of connectivity, which underlies the normal development of the limbic system. In animal studies there have been found that rats with increased level of anxiety had 1.6-fold higher expression of LsAMP gene in the periaqueductal gray compared to rats with low level of anxiety, indicating a possible role of LsAMP in the regulation of anxiety.
References
  • Zacco A. et al., 1990, The Journal of Neuroscience. 10(1): 73-90.
  • Pimenta AF. et al., 1996, Gene. 170(2) :189-95.
  • TOP