Human LSAMP Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGE567-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1017bp
Gene Synonym
LAMP, IGLON3, FLJ34254, FLJ35396, FLJ37216, FLJ54658, LSAMP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human limbic system-associated membrane protein Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The limbic system-associated membrane protein (LAMP) is a cell surface glycoprotein expressed by cortical and subcortical regions of the mammalian CNS that comprise or receive direct projections from limbic system structures. The 64-68-kDa glycoprotein limbic system-associated membrane protein (LsAMP) is expressed on the surface of somata and proximal dendrites of neurons. These areas perform cognitive and autonomic functions, also learning and memory. The functional analysis indicates that LsAMP acts as a selective adhesion molecule, serving as a guidance cue for specific patterns of connectivity, which underlies the normal development of the limbic system. In animal studies there have been found that rats with increased level of anxiety had 1.6-fold higher expression of LsAMP gene in the periaqueductal gray compared to rats with low level of anxiety, indicating a possible role of LsAMP in the regulation of anxiety.
References
  • Zacco A. et al., 1990, The Journal of Neuroscience. 10(1): 73-90.
  • Pimenta AF. et al., 1996, Gene. 170(2) :189-95.
  • TOP