Human Lipocalin 1/LCN1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGE379-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
531bp
Gene Synonym
TP, PMFA, VEGP, MGC71975, LCN1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lipocalin 1 (tear prealbumin) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lipocalin-1, also known as Von Ebner gland protein, VEG protein, Tear prealbumin, VEGP, Tear lipocalin and LCN1, is a secreted protein which belongs to the calycin superfamily and Lipocalin family. Human Lipocalin-1 / VEGP was originally described as a major protein of human tear fluid, which was thought to be tear specific. Lipocalin-1 / VEGP is identical with lingual von Ebner's gland protein, and is also produced in prostate, nasal mucosa and tracheal mucosa. Homologous proteins have been found in rat, pig and probably dog and horse. Lipocalin-1 / VEGP is an unusual lipocalin member, because of its high promiscuity for relative insoluble lipids and binding characteristics that differ from other members. Lipocalin-1 / VEGP acts as the principal lipid binding protein in tear fluid, a more general physiological function has to be proposed due to its wide distribution and properties. Lipocalin-1 / VEGP would be ideally suited for scavenging of lipophilic, potentially harmful substances and thus might act as a general protection factor of epithelia. Lipocalin-1 / LCN1 could play a role in taste reception. It could be necessary for the concentration and delivery of sapid molecules in the gustatory system. Lipocalin-1 / LCN1 can bind various ligands, with chemical structures ranging from lipids and retinoids to the macrocyclic antibiotic rifampicin and even to microbial siderophores. It exhibits an extremely wide ligand pocket.
References
  • Lassagne H. et al., 1993, Exp. Eye Res. 56:605-609.
  • Redl,B. et al., 2000, Biochim Biophys Acta  1482 (1-2):241-8.
  • Wojnar P. et al., 2001, J. Biol. Chem. 276:20206-20212.
  • Wojnar P. et al., 2003, J. Biol. Chem. 278:16209-16215.
  • Breustedt D.A. et al., 2005, J. Biol. Chem. 280:484-493.
  • TOP