Human Lipocalin 1/LCN1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_002297.2

RefSeq ORF Size

531bp

Gene Synonym

TP, PMFA, VEGP, MGC71975, LCN1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human lipocalin 1 (tear prealbumin) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lipocalin-1, also known as Von Ebner gland protein, VEG protein, Tear prealbumin, VEGP, Tear lipocalin and LCN1, is a secreted protein which belongs to the calycin superfamily and Lipocalin family. Human Lipocalin-1 / VEGP was originally described as a major protein of human tear fluid, which was thought to be tear specific. Lipocalin-1 / VEGP is identical with lingual von Ebner's gland protein, and is also produced in prostate, nasal mucosa and tracheal mucosa. Homologous proteins have been found in rat, pig and probably dog and horse. Lipocalin-1 / VEGP is an unusual lipocalin member, because of its high promiscuity for relative insoluble lipids and binding characteristics that differ from other members. Lipocalin-1 / VEGP acts as the principal lipid binding protein in tear fluid, a more general physiological function has to be proposed due to its wide distribution and properties. Lipocalin-1 / VEGP would be ideally suited for scavenging of lipophilic, potentially harmful substances and thus might act as a general protection factor of epithelia. Lipocalin-1 / LCN1 could play a role in taste reception. It could be necessary for the concentration and delivery of sapid molecules in the gustatory system. Lipocalin-1 / LCN1 can bind various ligands, with chemical structures ranging from lipids and retinoids to the macrocyclic antibiotic rifampicin and even to microbial siderophores. It exhibits an extremely wide ligand pocket.

References

Lassagne H. et al., 1993, Exp. Eye Res. 56:605-609.

Redl,B. et al., 2000, Biochim Biophys Acta 1482 (1-2):241-8.

Wojnar P. et al., 2001, J. Biol. Chem. 276:20206-20212.

Wojnar P. et al., 2003, J. Biol. Chem. 278:16209-16215.

Breustedt D.A. et al., 2005, J. Biol. Chem. 280:484-493.

Catalog Number:HGE379-NM