Human Leptin Receptor/CD295 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_002303.3

RefSeq ORF Size

3498bp

Gene Synonym

OBR, CD295

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human leptin receptor, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Leptin Receptor or CD295 belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Leptin Receptor/CD295 is a transmembrane catalytic receptors found on NPY/AgRP and alpha-MSH/CART neurons in hypothalamic nuclei. Leptin receptors (Ob-Rs) are coded for by one human gene that produces six different isoforms; Ob-Ra - Ob-Rf. Ob-Rs exist as constitutive dimers at physiological expression levels. Only the Ob-Rb isoform can transduce intracellular signals and does so through activation of the JAK2/STAT3, PI 3-K and MAPK signaling cascades. Activation of Ob-Rs mediates transcriptional regulation of the hypothalamic melanocortin pathway and downregulates endocannabinoid expression. Leptin acts via leptin receptors. Leptin resistance has been proposed as a pathophysiological mechanism of obesity. In obese individuals, Ob-Ra (which is involved in active transport of leptin across the blood-brain barrier) expression is downregulated and the individual may be unresponsive to leptin signals. Ob-R antagonists are of great interest in the development of pharmacological treatments for obesity. Mutations in Leptin Receptor/CD295 have been associated with obesity and pituitary dysfunction.

References

Heshka JT, et al. (2001) A role for dietary fat in leptin receptor, OB-Rb, function. Life Sci. 69 (9): 987-1003.

Chen H, et al (1996) Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell. 84 (3): 491-5.

Bjrbaek C, et al. (1998) Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem. 272 (51): 32686-95.

Catalog Number:HGE334-CY