Human Leptin Receptor/CD295 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_002303.3

RefSeq ORF Size

3498bp

Gene Synonym

OBR, CD295

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human leptin receptor, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Leptin Receptor or CD295 belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Leptin Receptor/CD295 is a transmembrane catalytic receptors found on NPY/AgRP and alpha-MSH/CART neurons in hypothalamic nuclei. Leptin receptors (Ob-Rs) are coded for by one human gene that produces six different isoforms; Ob-Ra - Ob-Rf. Ob-Rs exist as constitutive dimers at physiological expression levels. Only the Ob-Rb isoform can transduce intracellular signals and does so through activation of the JAK2/STAT3, PI 3-K and MAPK signaling cascades. Activation of Ob-Rs mediates transcriptional regulation of the hypothalamic melanocortin pathway and downregulates endocannabinoid expression. Leptin acts via leptin receptors. Leptin resistance has been proposed as a pathophysiological mechanism of obesity. In obese individuals, Ob-Ra (which is involved in active transport of leptin across the blood-brain barrier) expression is downregulated and the individual may be unresponsive to leptin signals. Ob-R antagonists are of great interest in the development of pharmacological treatments for obesity. Mutations in Leptin Receptor/CD295 have been associated with obesity and pituitary dysfunction.

References

Heshka JT, et al. (2001) A role for dietary fat in leptin receptor, OB-Rb, function. Life Sci. 69 (9): 987-1003.

Chen H, et al (1996) Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell. 84 (3): 491-5.

Bjrbaek C, et al. (1998) Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem. 272 (51): 32686-95.

Catalog Number:HGE334-CM