Human KEAP1/KEAP-1/INRF2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGE137-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1865bp
Gene Synonym
INrf2, KLHL19, MGC1114, MGC4407, MGC9454, KIAA0132, MGC10630, MGC20887, KEAP1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human kelch-like ECH-associated protein 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kelch-like ECH-associated protein 1, also known as cytosolic inhibitor of Nrf2, Kelch-like protein 19, KEAP1 and INRF2, is a cytoplasm and nucleus protein which contains one BACK (BTB/Kelch associated) domain, one BTB (POZ) domain and six Kelch repeats. KEAP1 / INRF2 is broadly expressed, with highest levels in skeletal muscle. KEAP1 / INRF2 is a key regulator of the NRF2 transcription factor, which transactivates the antioxidant response element (ARE) and upregulates numerous proteins involved in antioxidant defense. Under basal conditions, KEAP1 / INRF2 targets NRF2 for ubiquitination and proteolytic degradation and as such is responsible for the rapid turnover of NRF2. KEAP1 / INRF2 retains NFE2L2 / NRF2 in the cytosol. KEAP1 / INRF2 functions as substrate adapter protein for the E3 ubiquitin ligase complex formed by CUL3 and RBX1. It targets NFE2L2 / NRF2 for ubiquitination and degradation by the proteasome, thus resulting in the suppression of its transcriptional activity and the repression of antioxidant response element-mediated detoxifying enzyme gene expression. KEAP1 / INRF2 may also retain BPTF in the cytosol. It targets PGAM5 for ubiquitination and degradation by the proteasome.
References
  • Strachan GD. et al., 2004, Biochemistry. 43: 12113-22.
  • Zhang DD. et al., 2004, Mol Cell Biol. 24: 10941-53.
  • Zhang DD. et al., 2003, Mol Cell Biol. 23: 8137-51.
  • Lo S-C. et al., 2006, J Biol Chem. 281: 37893-903.
  • Buckley BJ. et al., 2008, Free Radic Biol Med. 44 (4) :692-8.
  • TOP