Human KEAP1/KEAP-1/INRF2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGE137-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1865bp
Gene Synonym
INrf2, KLHL19, MGC1114, MGC4407, MGC9454, KIAA0132, MGC10630, MGC20887, KEAP1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human kelch-like ECH-associated protein 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kelch-like ECH-associated protein 1, also known as cytosolic inhibitor of Nrf2, Kelch-like protein 19, KEAP1 and INRF2, is a cytoplasm and nucleus protein which contains one BACK (BTB/Kelch associated) domain, one BTB (POZ) domain and six Kelch repeats. KEAP1 / INRF2 is broadly expressed, with highest levels in skeletal muscle. KEAP1 / INRF2 is a key regulator of the NRF2 transcription factor, which transactivates the antioxidant response element (ARE) and upregulates numerous proteins involved in antioxidant defense. Under basal conditions, KEAP1 / INRF2 targets NRF2 for ubiquitination and proteolytic degradation and as such is responsible for the rapid turnover of NRF2. KEAP1 / INRF2 retains NFE2L2 / NRF2 in the cytosol. KEAP1 / INRF2 functions as substrate adapter protein for the E3 ubiquitin ligase complex formed by CUL3 and RBX1. It targets NFE2L2 / NRF2 for ubiquitination and degradation by the proteasome, thus resulting in the suppression of its transcriptional activity and the repression of antioxidant response element-mediated detoxifying enzyme gene expression. KEAP1 / INRF2 may also retain BPTF in the cytosol. It targets PGAM5 for ubiquitination and degradation by the proteasome.
References
  • Strachan GD. et al., 2004, Biochemistry. 43: 12113-22.
  • Zhang DD. et al., 2004, Mol Cell Biol. 24: 10941-53.
  • Zhang DD. et al., 2003, Mol Cell Biol. 23: 8137-51.
  • Lo S-C. et al., 2006, J Biol Chem. 281: 37893-903.
  • Buckley BJ. et al., 2008, Free Radic Biol Med. 44 (4) :692-8.
  • TOP