Human JAML/AMICA1 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:HGE077-NG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1185bp
Gene Synonym
JAML, AMICA, Gm638, CREA7-1, CREA7-4, FLJ37080, MGC118814, MGC118815, AMICA1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human adhesion molecule, interacts with CXADR antigen 1, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Junctional adhesion molecules (JAMs) are endothelial and epithelial adhesion molecules involved in the recruitment of circulating leukocytes to inflammatory sites. JAML (Junctional adhesion molecule-like), also known as AMICA1 (Adhesion molecule interacting with CXADR antigen 1), a protein related to the JAM family, is restricted to leukocytes and promotes their adhesion to endothelial cells. It contains 2 extracellular immunoglobulin-like domains, a transmembrane segment, and a cytoplasmic tail involved in activation signaling. Monocytic JAML/AMICA1 plays a critical role in regulating monocyte transendothelial migration (TEM) probably via binding to the endothelial coxsackie and adenovirus receptor (CAR) and other tight junction-associated adhesive molecules. The Expression of JAML/AMICA1 is restricted to the hematopoietic tissues with the exception of liver. JAML may function in transmigration of leukocytes through epithelial and endothelial tissues. Expressed at the plasma membrane of polymorphonuclear leukocytes, JAML/AMICA1 also enhances myeloid leukemia cell adhesion to endothelial cells.
References
  • Moog-Lutz C, et al. (2003) JAML, a novel protein with characteristics of a junctional adhesion molecule, is induced during differentiation of myeloid leukemia cells. Blood. 102(9): 3371-8.
  • Luissint AC, et al. (2008) JAM-L-mediated leukocyte adhesion to endothelial cells is regulated in cis by alpha4beta1 integrin activation. J Cell Biol. 183(6): 1159-73.
  • Guo YL, et al. (2009) Role of junctional adhesion molecule-like protein in mediating monocyte transendothelial migration. Arterioscler Thromb Vasc Biol. 29(1): 75-83.
  • TOP