Human JAML/AMICA1 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGE077-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1185bp
Gene Synonym
JAML, AMICA, Gm638, CREA7-1, CREA7-4, FLJ37080, MGC118814, MGC118815, AMICA1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human adhesion molecule, interacts with CXADR antigen 1, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Junctional adhesion molecules (JAMs) are endothelial and epithelial adhesion molecules involved in the recruitment of circulating leukocytes to inflammatory sites. JAML (Junctional adhesion molecule-like), also known as AMICA1 (Adhesion molecule interacting with CXADR antigen 1), a protein related to the JAM family, is restricted to leukocytes and promotes their adhesion to endothelial cells. It contains 2 extracellular immunoglobulin-like domains, a transmembrane segment, and a cytoplasmic tail involved in activation signaling. Monocytic JAML/AMICA1 plays a critical role in regulating monocyte transendothelial migration (TEM) probably via binding to the endothelial coxsackie and adenovirus receptor (CAR) and other tight junction-associated adhesive molecules. The Expression of JAML/AMICA1 is restricted to the hematopoietic tissues with the exception of liver. JAML may function in transmigration of leukocytes through epithelial and endothelial tissues. Expressed at the plasma membrane of polymorphonuclear leukocytes, JAML/AMICA1 also enhances myeloid leukemia cell adhesion to endothelial cells.
References
  • Moog-Lutz C, et al. (2003) JAML, a novel protein with characteristics of a junctional adhesion molecule, is induced during differentiation of myeloid leukemia cells. Blood. 102(9): 3371-8.
  • Luissint AC, et al. (2008) JAM-L-mediated leukocyte adhesion to endothelial cells is regulated in cis by alpha4beta1 integrin activation. J Cell Biol. 183(6): 1159-73.
  • Guo YL, et al. (2009) Role of junctional adhesion molecule-like protein in mediating monocyte transendothelial migration. Arterioscler Thromb Vasc Biol. 29(1): 75-83.
  • TOP