Human IL1RL1/IL‑1 R4 transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_003856.2

RefSeq ORF Size

987bp

Gene Synonym

IL1RL1, T1, ST2, DER4, ST2L, ST2V, FIT-1, MGC32623

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human interleukin 1 receptor-like 1, transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

KpnI + NotI (6kb + 1.03kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IL-1 receptor–like 1 (IL1RL1) is a membrane receptor involved in TH2 inflammatory responses and eosinophilia. It has previously been described that levels of the interlukin-1 like 1 (IL1RL1) protein can be used to diagnose cardiovascular disease and determine the prognosis for a patient with cardiovascular disease. The ligand for IL1RL1 has been described, and named IL-33. Mutants in IL1RL1 have been associated with blood eosinophil counts in a genome-wide association study and with asthma in family-based and case-control studies. As an important mediator involved in many immune and inflammatory responses, this cytokine has been implicated as a regulator of both the development and effector phases of type 2 helper T cell responses, and as a negative feedback modulator of macrophage pro-inflammatory function. IL33 is a specific ligand of ST2L and induces production of Th2 cytokines.

References

Savenije OE, et al. (2011) Interleukin-1 receptor-like 1 polymorphisms are associated with serum IL1RL1-a, eosinophils, and asthma in childhood. J Allergy Clin Immunol. 127(3): 750-6.

Li H, et al. (2000) The cloning and nucleotide sequence of human ST2L cDNA. Genomics. 67(3): 284-90.

Catalog Number:HGD941-NY