Human IL1RL1/IL‑1 R4 transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGD941-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
987bp
Gene Synonym
IL1RL1, T1, ST2, DER4, ST2L, ST2V, FIT-1, MGC32623
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 receptor-like 1, transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
KpnI + NotI (6kb + 1.03kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IL-1 receptor–like 1 (IL1RL1) is a membrane receptor involved in TH2 inflammatory responses and eosinophilia. It has previously been described that levels of the interlukin-1 like 1 (IL1RL1) protein can be used to diagnose cardiovascular disease and determine the prognosis for a patient with cardiovascular disease. The ligand for IL1RL1 has been described, and named IL-33. Mutants in IL1RL1 have been associated with blood eosinophil counts in a genome-wide association study and with asthma in family-based and case-control studies. As an important mediator involved in many immune and inflammatory responses, this cytokine has been implicated as a regulator of both the development and effector phases of type 2 helper T cell responses, and as a negative feedback modulator of macrophage pro-inflammatory function. IL33 is a specific ligand of ST2L and induces production of Th2 cytokines.
References
  • Savenije OE, et al. (2011) Interleukin-1 receptor-like 1 polymorphisms are associated with serum IL1RL1-a, eosinophils, and asthma in childhood. J Allergy Clin Immunol. 127(3): 750-6.
  • Li H, et al. (2000) The cloning and nucleotide sequence of human ST2L cDNA. Genomics. 67(3): 284-90.
  • TOP