Human IL12RB1(CD212) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_005535.1

RefSeq ORF Size

1989bp

Gene Synonym

CD212, IL12RB, MGC34454, IL-12R-BETA1, IL12RB1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human interleukin 12 receptor, beta 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin 12 receptor, beta 1 is also known as IL-12 receptor beta component, IL-12R subunit beta-1, and CD212 antigen (CD212). IL12RB1(CD212) is a subunit of the interleukin 12 receptor. IL12RB1(CD212) is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. IL12RB1(CD212) forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of IL12RB1 and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The lack of expression of this gene was found to result in the immunodeficiency of patients with severe mycobacterial and Salmonella infections. IL12RB1(CD212) Functions as an interleukin receptor which binds interleukin-12 with low affinity and is involved in IL12 transduction. It associated with IL12RB2 it forms a functional, high affinity receptor for IL12. IL12RB1(CD212) associates also with IL23R to form the interleukin-23 receptor which functions in IL23 signal transduction probably through activation of the Jak-Stat signaling cascade.

References

Cleary AM, et al. (2003) Impaired accumulation and function of memory CD4 T cells in human IL-12 receptor beta 1 deficiency. J Immunol. 170 (1): 597-603.

Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2): 149-56.

Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. Cell Genet. 77 (3-4): 257-8.

Catalog Number:HGD918-CY