Human IL12RB1(CD212) Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:HGD918-CG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1989bp
Gene Synonym
CD212, IL12RB, MGC34454, IL-12R-BETA1, IL12RB1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 12 receptor, beta 1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 12 receptor, beta 1 is also known as IL-12 receptor beta component, IL-12R subunit beta-1, and CD212 antigen (CD212). IL12RB1(CD212) is a subunit of the interleukin 12 receptor. IL12RB1(CD212) is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. IL12RB1(CD212) forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of IL12RB1 and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The lack of expression of this gene was found to result in the immunodeficiency of patients with severe mycobacterial and Salmonella infections. IL12RB1(CD212) Functions as an interleukin receptor which binds interleukin-12 with low affinity and is involved in IL12 transduction. It associated with IL12RB2 it forms a functional, high affinity receptor for IL12. IL12RB1(CD212) associates also with IL23R to form the interleukin-23 receptor which functions in IL23 signal transduction probably through activation of the Jak-Stat signaling cascade.
References
  • Cleary AM, et al. (2003) Impaired accumulation and function of memory CD4 T cells in human IL-12 receptor beta 1 deficiency. J Immunol. 170 (1): 597-603.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2): 149-56.
  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. Cell Genet. 77 (3-4): 257-8.
  • TOP