Human IL-1RAcP/IL-1R3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_002182.2

RefSeq ORF Size

1746 bp

Gene Synonym

C3orf13,IL-1RAcP,IL1R3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human interleukin 1 receptor accessory protein Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

KpnI + XbaI(6kb+1.75kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-1 receptor accessory protein (IL-1RAcP) also known as Interleukin-1 receptor member 3 (IL-1R3) is a a cytokine receptor which binds interleukin 1. The IL-1 receptor accessory protein (IL1RAP) is a transmembrane protein that interacts with IL-1R and is required for IL-1 signal transduction. Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. IL-1RAcP/IL-1R3 is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. IL-1RAcP/IL-1R3 mediates interleukin-1-dependent activation of NF-kappa-B. Isoform 1 is part of the membrane-bound form of the IL-1 receptor. Signaling involves formation of a ternary complex containing IL1R1, TOLLIP, MYD88, and IRAK1 or IRAK2. Isoform 2 modulates the response to interleukins by associating with soluble IL1R1 and enhancing interleukin-binding to the decoy receptor.

References

Goldbach-Mansky R, et al. (2009) Autoinflammation: the prominent role of IL-1 in monogenic autoinflammatory diseases and implications for common illnesses. J Allergy Clin Immunol. 124(6): 1141-9.

Johnston A, et al. (2011) IL-1F5, -F6, -F8, and -F9: a novel IL-1 family signaling system that is active in psoriasis and promotes keratinocyte antimicrobial peptide expression. J Immunol. 186(4): 2613-22.

Ozaki K, et al. (2001) Effect of tumor weight and tube feeding on TNF-alpha and IL-1beta mRNA expression in the brain of mice. JPEN J Parenter Enteral Nutr. 25(6): 317-22.

Catalog Number:HGD889-NY