Human IL-1RAcP/IL-1R3 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGD889-NH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1746 bp
Gene Synonym
C3orf13,IL-1RAcP,IL1R3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 receptor accessory protein Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
KpnI + XbaI(6kb+1.75kb)
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-1 receptor accessory protein (IL-1RAcP) also known as Interleukin-1 receptor member 3 (IL-1R3) is a a cytokine receptor which binds interleukin 1. The IL-1 receptor accessory protein (IL1RAP) is a transmembrane protein that interacts with IL-1R and is required for IL-1 signal transduction. Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. IL-1RAcP/IL-1R3 is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. IL-1RAcP/IL-1R3 mediates interleukin-1-dependent activation of NF-kappa-B. Isoform 1 is part of the membrane-bound form of the IL-1 receptor. Signaling involves formation of a ternary complex containing IL1R1, TOLLIP, MYD88, and IRAK1 or IRAK2. Isoform 2 modulates the response to interleukins by associating with soluble IL1R1 and enhancing interleukin-binding to the decoy receptor.
References
  • Goldbach-Mansky R, et al. (2009) Autoinflammation: the prominent role of IL-1 in monogenic autoinflammatory diseases and implications for common illnesses. J Allergy Clin Immunol. 124(6): 1141-9.
  • Johnston A, et al. (2011) IL-1F5, -F6, -F8, and -F9: a novel IL-1 family signaling system that is active in psoriasis and promotes keratinocyte antimicrobial peptide expression. J Immunol. 186(4): 2613-22.
  • Ozaki K, et al. (2001) Effect of tumor weight and tube feeding on TNF-alpha and IL-1beta mRNA expression in the brain of mice. JPEN J Parenter Enteral Nutr. 25(6): 317-22.
  • TOP