Human IL-1R9/IL1RAPL2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGD886-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2061bp
Gene Synonym
IL1RAPL2, IL1R9, IL-1R9, TIGIRR-1, IL1RAPL-2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 receptor accessory protein-like 2 (IL1RAPL2) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) or Interleukin-1 receptor 9 (IL-1R9) is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins. IL-1R9/IL1RAPL2 shows restricted expression in fetal brain and is highly homologous to IL1RAPL, which is reportedly involved in nonsyndromic X-linked mental retardation. IL-1R9/IL1RAPL2 is highly homologous to IL-1R8. Both forms have no known ligands and receptor are found in the fetal brain. IL-1R9/IL1RAPL2 may function as a negative receptor. Both IL1RAPL1 and IL1RAPL2 have novel C-terminal sequences not present in other related proteins. IL-1R9/IL1RAPL2 may be strong candidates for X-linked non-syndromic mental retardation loci, and that molecules resembling IL-1 and IL-18 play a role in the development or function of the central nervous system.
References
  • Jin H, et al. (2000) Two novel members of the interleukin-1 receptor gene family, one deleted in Xp22.1-Xp21.3 mental retardation. Eur J Hum Genet. 8(2): 87-94.
  • Sana TR, et al. (2000) Computational identification, cloning, and characterization of IL-1R9, a novel interleukin-1 receptor-like gene encoded over an unusually large interval of human chromosome Xq22.2-q22.3. Genomics. 69(2): 252-62.
  • Gambino F, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104(21): 9063-8.
  • TOP