Human IL-1R9/IL1RAPL2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGD886-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2061bp
Gene Synonym
IL1RAPL2, IL1R9, IL-1R9, TIGIRR-1, IL1RAPL-2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 receptor accessory protein-like 2 (IL1RAPL2) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) or Interleukin-1 receptor 9 (IL-1R9) is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins. IL-1R9/IL1RAPL2 shows restricted expression in fetal brain and is highly homologous to IL1RAPL, which is reportedly involved in nonsyndromic X-linked mental retardation. IL-1R9/IL1RAPL2 is highly homologous to IL-1R8. Both forms have no known ligands and receptor are found in the fetal brain. IL-1R9/IL1RAPL2 may function as a negative receptor. Both IL1RAPL1 and IL1RAPL2 have novel C-terminal sequences not present in other related proteins. IL-1R9/IL1RAPL2 may be strong candidates for X-linked non-syndromic mental retardation loci, and that molecules resembling IL-1 and IL-18 play a role in the development or function of the central nervous system.
References
  • Jin H, et al. (2000) Two novel members of the interleukin-1 receptor gene family, one deleted in Xp22.1-Xp21.3 mental retardation. Eur J Hum Genet. 8(2): 87-94.
  • Sana TR, et al. (2000) Computational identification, cloning, and characterization of IL-1R9, a novel interleukin-1 receptor-like gene encoded over an unusually large interval of human chromosome Xq22.2-q22.3. Genomics. 69(2): 252-62.
  • Gambino F, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104(21): 9063-8.
  • TOP