Mouse IkB alpha/NFKBIA Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGD868-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
945bp
Gene Synonym
Nfkbi; AI462015
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.
References
  • Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.
  • Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.
  • Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.
  • Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.
  • Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.
  • TOP