Mouse IkB alpha/NFKBIA Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010907.2

RefSeq ORF Size

945bp

Gene Synonym

Nfkbi; AI462015

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.

References

Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.

Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.

Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.

Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.

Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.

Catalog Number:HGD868-CF