Human IGJ Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGD857-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
480bp
Gene Synonym
JCH; IGCJ
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Immunoglobulin J chain, also known as IGJ and IGCJ, is a secreted polypeptide which is the first immunoglobulin-related polypeptide expressed during the embryogenesis and differentiation of B cells in the fetal liver. The joining Immunoglobulin J chain is a small polypeptide, expressed by mucosal and glandular plasma cells, which regulates polymer formation of immunoglobulin (Ig)A and IgM. Immunoglobulin J chain / IGJ serves to link two monomer units of either IgM or IgA. In the case of IgM, the J chain-joined dimer is a nucleating unit for the IgM pentamer, and in the case of IgA it induces larger polymers. Immunoglobulin J chain / IGJ also help to bind these immunoglobulins to secretory component. J-chain incorporation into polymeric IgA (pIgA, mainly dimers) and pentameric IgM endows these antibodies with several salient features. Immunoglobulin J chain / IGJ is involved in creating the binding site for pIgR / SC in the Ig polymers, not only by determining the polymeric quaternary structure but apparently also by interacting directly with the receptor protein. Both the immunoglobulin J chain / IGJ and the pIgR/SC are key proteins in secretory immunity.
References
  • Zikan, J. et al., 1985, Proc Natl Acad Sci USA. 82 (17): 5905-9.
  • Koshland, M.E. et al., 1985, Annu Rev Immunol. 3: 425-53.
  • Iwase,T. et al., 1993, Cell Struct Funct. 18 (5): 297-302.
  • Johansen, F.E. et al., 2000, Scand J Immunol. 52 (3): 240-8.
  • Lim, J.H. et al., 2006, J Immunol. 177 (8): 5420-9. 
  • TOP