Human IGJ Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_144646.3

RefSeq ORF Size

480bp

Gene Synonym

JCH; IGCJ

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Immunoglobulin J chain, also known as IGJ and IGCJ, is a secreted polypeptide which is the first immunoglobulin-related polypeptide expressed during the embryogenesis and differentiation of B cells in the fetal liver. The joining Immunoglobulin J chain is a small polypeptide, expressed by mucosal and glandular plasma cells, which regulates polymer formation of immunoglobulin (Ig)A and IgM. Immunoglobulin J chain / IGJ serves to link two monomer units of either IgM or IgA. In the case of IgM, the J chain-joined dimer is a nucleating unit for the IgM pentamer, and in the case of IgA it induces larger polymers. Immunoglobulin J chain / IGJ also help to bind these immunoglobulins to secretory component. J-chain incorporation into polymeric IgA (pIgA, mainly dimers) and pentameric IgM endows these antibodies with several salient features. Immunoglobulin J chain / IGJ is involved in creating the binding site for pIgR / SC in the Ig polymers, not only by determining the polymeric quaternary structure but apparently also by interacting directly with the receptor protein. Both the immunoglobulin J chain / IGJ and the pIgR/SC are key proteins in secretory immunity.

References

Zikan, J. et al., 1985, Proc Natl Acad Sci USA. 82 (17): 5905-9.

Koshland, M.E. et al., 1985, Annu Rev Immunol. 3: 425-53.

Iwase,T. et al., 1993, Cell Struct Funct. 18 (5): 297-302.

Johansen, F.E. et al., 2000, Scand J Immunol. 52 (3): 240-8.

Lim, J.H. et al., 2006, J Immunol. 177 (8): 5420-9.

Catalog Number:HGD857-CM