Human IFI30 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_006332.4

RefSeq ORF Size

753bp

Gene Synonym

GILT, IP30, IFI-30

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human interferon, gamma-inducible protein 30 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IFI30 belongs to the GILT family. This family includes the two characterised human gamma-interferon-inducible lysosomal thiol reductase (GILT) sequences: P13284 and Q9UL08. It also contains several other eukaryotic putative proteins with similarity to GILT. The aligned region contains three conserved cysteine residues. In addition, the two GILT sequences possess a C-X(2)-C motif that is shared by some of the other sequences in the family. This motif is thought to be associated with disulphide bond reduction. IFI30 is a lysosomal thiol reductase that can reduce protein disulfide bonds. It facilitates the generation of MHC class II-restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. It also facilitates MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation. IFI30 may facilitate the complete unfolding of proteins destined for lysosomal degradation and plays an important role in antigen processing.

References

Haque MA, et al. (2002) Absence of gamma-Interferon-inducible Lysosomal Thiol Reductase in Melanomas Disrupts T Cell Recognition of Select Immunodominant Epitopes. J Exp Med. 195(10):1267-77.

Phan UT, et al. (2000) Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action. J Biol Chem. 275(34):25907-14.

Phan UT, et al. (2001) Multiple species express thiol oxidoreductases related to GILT. Immunogenetics. 53(4):342-6.

Catalog Number:HGD802-NF