Human IFI30 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGD802-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
753bp
Gene Synonym
GILT, IP30, IFI-30
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interferon, gamma-inducible protein 30 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IFI30 belongs to the GILT family. This family includes the two characterised human gamma-interferon-inducible lysosomal thiol reductase (GILT) sequences: P13284 and Q9UL08. It also contains several other eukaryotic putative proteins with similarity to GILT. The aligned region contains three conserved cysteine residues. In addition, the two GILT sequences possess a C-X(2)-C motif that is shared by some of the other sequences in the family. This motif is thought to be associated with disulphide bond reduction. IFI30 is a lysosomal thiol reductase that can reduce protein disulfide bonds. It facilitates the generation of MHC class II-restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. It also facilitates MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation. IFI30 may facilitate the complete unfolding of proteins destined for lysosomal degradation and plays an important role in antigen processing.
References
  • Haque MA, et al. (2002) Absence of gamma-Interferon-inducible Lysosomal Thiol Reductase in Melanomas Disrupts T Cell Recognition of Select Immunodominant Epitopes. J Exp Med. 195(10):1267-77.
  • Phan UT, et al. (2000) Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action. J Biol Chem. 275(34):25907-14.
  • Phan UT, et al. (2001) Multiple species express thiol oxidoreductases related to GILT. Immunogenetics. 53(4):342-6.
  • TOP