Human IDO2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

RefSeq ORF Size

1308 bp

Gene Synonym

INDOL1, IDO2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human indoleamine 2,3-dioxygenase 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

KpnI + XbaI(6kb+1.31kb)

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IDO2 belongs to the indoleamine 2,3-dioxygenase family. Indoleamine 2,3-dioxgyenase (IDO), is a cytosolic haem protein which, together with the hepatic enzyme tryptophan 2,3-dioxygenase, catalyzes the conversion of tryptophan and other indole derivatives to kynurenines. In addition to classic IDO (IDO1), a new variant, IDO2, has recently been described. IDO2 is expressed in liver, small intestine, spleen, placenta, thymus, lung, brain, kidney, and colon. IDO is widely distributed in human tissues, its physiological role is not fully understood but is of great interest. IDO can be up-regulated via cytokines such as interferon-gamma, and can thereby modulate the levels of tryptophan, which is vital for cell growth. In humans and mice, the IDO1 and IDO2 genes are present tandemly in a tail-to-head arrangment on chromosome 8. In lower vertebrates such as zebrafish and toads only a single IDO gene may be present that may be more IDO2-like in structure. This closer relationship to IDO2 suggests that IDO2 may actually be the ancestor of the better characterized IDO1 gene, and that IDO1 might have been generated by gene duplication of IDO2 before the origin of tetrapods in mammalian evolutionary history. IDO2 catalyzes the first and rate-limiting step in the kynurenine pathway of tryptophan catabolism.

References

Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.

Sorensen RB, et al. (2011) Spontaneous cytotoxic T-Cell reactivity against indoleamine 2,3-dioxygenase-2. Cancer Res. 71 (6): 2038-44.

Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.

Catalog Number:HGD797-CO