Human IDO2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

RefSeq ORF Size

1308 bp

Gene Synonym

INDOL1, IDO2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human indoleamine 2,3-dioxygenase 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

KpnI + XbaI(6kb+1.31kb)

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IDO2 belongs to the indoleamine 2,3-dioxygenase family. Indoleamine 2,3-dioxgyenase (IDO), is a cytosolic haem protein which, together with the hepatic enzyme tryptophan 2,3-dioxygenase, catalyzes the conversion of tryptophan and other indole derivatives to kynurenines. In addition to classic IDO (IDO1), a new variant, IDO2, has recently been described. IDO2 is expressed in liver, small intestine, spleen, placenta, thymus, lung, brain, kidney, and colon. IDO is widely distributed in human tissues, its physiological role is not fully understood but is of great interest. IDO can be up-regulated via cytokines such as interferon-gamma, and can thereby modulate the levels of tryptophan, which is vital for cell growth. In humans and mice, the IDO1 and IDO2 genes are present tandemly in a tail-to-head arrangment on chromosome 8. In lower vertebrates such as zebrafish and toads only a single IDO gene may be present that may be more IDO2-like in structure. This closer relationship to IDO2 suggests that IDO2 may actually be the ancestor of the better characterized IDO1 gene, and that IDO1 might have been generated by gene duplication of IDO2 before the origin of tetrapods in mammalian evolutionary history. IDO2 catalyzes the first and rate-limiting step in the kynurenine pathway of tryptophan catabolism.

References

Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.

Sorensen RB, et al. (2011) Spontaneous cytotoxic T-Cell reactivity against indoleamine 2,3-dioxygenase-2. Cancer Res. 71 (6): 2038-44.

Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.

Catalog Number:HGD797-CF