Human HSP70/HSPA1A Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_005345.5

RefSeq ORF Size

1926bp

Gene Synonym

HSP72, HSPA1, HSP70I, HSPA1B, HSP70-1, FLJ54303, FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1A, HSPA1A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human heat shock 70kDa protein 1A Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

HSPA1A is a member of the Hsp70 protein family. The 70 kilodalton heat shock proteins (Hsp70s) are a family of ubiquitously expressed heat shock proteins. HSP are abundant and conserved proteins present in all cells. Upon temperature shock or other stress stimuli, HSP are synthesized intracellularly, which may protect cells from protein denaturation or from death. Extracellularly, HSP can serve a cytokine function to initiate both innate and adaptive immunity through activation of APC. HSP serves also a chaperone function and facilitates presentation of antigen peptide to T cells. Molecular chaperones of the Hsp70 family have diverse functions in cells. They assist the folding of newly synthesized and stress-denatured proteins, as well as the import of proteins into organelles, and the dissociation of aggregated proteins. The well-conserved Hsp70 chaperones are ATP dependent: binding and hydrolysis of ATP regulates their interactions with unfolded polypeptide substrates, and ATPase cycling is necessary for their function. All cellular functions of Hsp70 chaperones use the same mechanism of ATP-driven polypeptide binding and release.

References

Heck TG, et al. (2011) HSP70 expression: does it a novel fatigue signalling factor from immune system to the brain Cell Biochem Funct. 29 (3): 215-26.

Chen T, et al. (2010) Stress for maintaining memory: HSP70 as a mobile messenger for innate and adaptive immunity. Eur J Immunol. 40 (6): 1541-4.

Young JC. (2010) Mechanisms of the Hsp70 chaperone system. Biochem Cell Biol. 88 (2): 291-300.

Catalog Number:HGD738-NY