Human HSP70/HSPA1A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_005345.5

RefSeq ORF Size

1926bp

Gene Synonym

HSP72, HSPA1, HSP70I, HSPA1B, HSP70-1, FLJ54303, FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1A, HSPA1A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human heat shock 70kDa protein 1A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

HSPA1A is a member of the Hsp70 protein family. The 70 kilodalton heat shock proteins (Hsp70s) are a family of ubiquitously expressed heat shock proteins. HSP are abundant and conserved proteins present in all cells. Upon temperature shock or other stress stimuli, HSP are synthesized intracellularly, which may protect cells from protein denaturation or from death. Extracellularly, HSP can serve a cytokine function to initiate both innate and adaptive immunity through activation of APC. HSP serves also a chaperone function and facilitates presentation of antigen peptide to T cells. Molecular chaperones of the Hsp70 family have diverse functions in cells. They assist the folding of newly synthesized and stress-denatured proteins, as well as the import of proteins into organelles, and the dissociation of aggregated proteins. The well-conserved Hsp70 chaperones are ATP dependent: binding and hydrolysis of ATP regulates their interactions with unfolded polypeptide substrates, and ATPase cycling is necessary for their function. All cellular functions of Hsp70 chaperones use the same mechanism of ATP-driven polypeptide binding and release.

References

Heck TG, et al. (2011) HSP70 expression: does it a novel fatigue signalling factor from immune system to the brain Cell Biochem Funct. 29 (3): 215-26.

Chen T, et al. (2010) Stress for maintaining memory: HSP70 as a mobile messenger for innate and adaptive immunity. Eur J Immunol. 40 (6): 1541-4.

Young JC. (2010) Mechanisms of the Hsp70 chaperone system. Biochem Cell Biol. 88 (2): 291-300.

Catalog Number:HGD738-NM