Human GSTK1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGD319-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681bp
Gene Synonym
HDCMD47P, GST, GST 13-13, GST13, GST13-13, GSTK1-1, hGSTK1, GSTK1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glutathione S-transferase kappa 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GSTK1 gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. Glutathione S-transferases (GSTs) are a family of enzymes that catalyze a variety of reactions in both eukaryotes and prokaryotes. They catalyze the conjugation of reduced glutathione with potentially toxic, xenobiotic substrates, thus aiding excretion from the body. GSTK1(glutathione S-transferase kappa 1) is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. GSTK1 functions in cellular detoxification.
References
  • Zhang QH, et al. (2001) Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. Genome Res. 10(10):1546-60.
  • Morel F, et al. (2004) Gene and protein characterization of the human glutathione S-transferase kappa and evidence for a peroxisomal localization. J Biol Chem. 279(16): 16246-53.
  • Jowsey IR, et al. (2003) Biochemical and genetic characterization of a murine class Kappa glutathione S-transferase. Biochem J. 373(Pt 2):559-69.
  • TOP