Human GSTK1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGD319-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681bp
Gene Synonym
HDCMD47P, GST, GST 13-13, GST13, GST13-13, GSTK1-1, hGSTK1, GSTK1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glutathione S-transferase kappa 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GSTK1 gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. Glutathione S-transferases (GSTs) are a family of enzymes that catalyze a variety of reactions in both eukaryotes and prokaryotes. They catalyze the conjugation of reduced glutathione with potentially toxic, xenobiotic substrates, thus aiding excretion from the body. GSTK1(glutathione S-transferase kappa 1) is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. GSTK1 functions in cellular detoxification.
References
  • Zhang QH, et al. (2001) Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. Genome Res. 10(10):1546-60.
  • Morel F, et al. (2004) Gene and protein characterization of the human glutathione S-transferase kappa and evidence for a peroxisomal localization. J Biol Chem. 279(16): 16246-53.
  • Jowsey IR, et al. (2003) Biochemical and genetic characterization of a murine class Kappa glutathione S-transferase. Biochem J. 373(Pt 2):559-69.
  • TOP