Human GALNAC4S-6ST/CHST15 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_015892.2

RefSeq ORF Size

1686bp

Gene Synonym

KIAA0598, MGC34346, RP11-47G11.1, DKFZp781H1369

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carbohydrate sulfotransferase 15, also known as N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, GalNAc4S-6ST, B-cell RAG-associated gene protein, CHST15 and BRAG, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family. CHST15 / BRAG is expressed in B-cell-enriched tissues but not in fetal or adult thymus. It is expressed in fetal and adult spleen, lymph node, tonsil, bone marrow and peripheral leukocytes. It is not expressed in T-cells. In pro-B, pre-B, and mature B-cell lines, it colocalizes with RAG1. CHST15 / BRAG is a sulfotransferase that transfers sulfate from 3'-phosphoadenosine 5'-phosphosulfate (PAPS) to the C-6 hydroxyl group of the GalNAc 4-sulfate residue of chondroitin sulfate A and forms chondroitin sulfate E containing GlcA-GalNAc(4,6-SO4) repeating units. It also transfers sulfate to a unique non-reducing terminal sequence, GalNAc(4SO4)-GlcA(2SO4)-GalNAc(6SO4), to yield a highly sulfated structure similar to the structure found in thrombomodulin chondroitin sulfate. CHST15 / BRAG may also act as a B-cell receptor involved in BCR ligation-mediated early activation that mediate regulatory signals key to B-cell development and / or regulation of B-cell-specific RAG expression.

References

Catalog Number:HGD005-NM