Human GALNAC4S-6ST/CHST15 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_015892.2

RefSeq ORF Size

1686bp

Gene Synonym

KIAA0598, MGC34346, RP11-47G11.1, DKFZp781H1369

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carbohydrate sulfotransferase 15, also known as N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, GalNAc4S-6ST, B-cell RAG-associated gene protein, CHST15 and BRAG, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family. CHST15 / BRAG is expressed in B-cell-enriched tissues but not in fetal or adult thymus. It is expressed in fetal and adult spleen, lymph node, tonsil, bone marrow and peripheral leukocytes. It is not expressed in T-cells. In pro-B, pre-B, and mature B-cell lines, it colocalizes with RAG1. CHST15 / BRAG is a sulfotransferase that transfers sulfate from 3'-phosphoadenosine 5'-phosphosulfate (PAPS) to the C-6 hydroxyl group of the GalNAc 4-sulfate residue of chondroitin sulfate A and forms chondroitin sulfate E containing GlcA-GalNAc(4,6-SO4) repeating units. It also transfers sulfate to a unique non-reducing terminal sequence, GalNAc(4SO4)-GlcA(2SO4)-GalNAc(6SO4), to yield a highly sulfated structure similar to the structure found in thrombomodulin chondroitin sulfate. CHST15 / BRAG may also act as a B-cell receptor involved in BCR ligation-mediated early activation that mediate regulatory signals key to B-cell development and / or regulation of B-cell-specific RAG expression.

References

Catalog Number:HGD005-CF