Mouse Frizzled-10/FZD10 (CD350) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGC905-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1749bp
Gene Synonym
Fz-10, Fzd10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse frizzled homolog 10 (Drosophila) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Frizzled-10, also known as Fz-10, CD350 and FZD10, is a multi-pass membrane protein which belongs to the G-protein coupled receptor Fz/Smo family. Frizzled-10 / FZD10 is abundantly expressed in the cerebellum, followed by cerebral cortex, medulla and spinal cord; very low levels in total brain, frontal lobe, temporal lobe and putamen. It is weakly expressed in adult brain, heart, lung, skeletal muscle, pancreas, spleen and prostate. Frizzled-10 / FZD10 is a receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-10 / FZD10 may also be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.
References
TOP