Mouse Frizzled-10/FZD10 (CD350) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGC905-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1749bp
Gene Synonym
Fz-10, Fzd10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse frizzled homolog 10 (Drosophila) Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Frizzled-10, also known as Fz-10, CD350 and FZD10, is a multi-pass membrane protein which belongs to the G-protein coupled receptor Fz/Smo family. Frizzled-10 / FZD10 is abundantly expressed in the cerebellum, followed by cerebral cortex, medulla and spinal cord; very low levels in total brain, frontal lobe, temporal lobe and putamen. It is weakly expressed in adult brain, heart, lung, skeletal muscle, pancreas, spleen and prostate. Frizzled-10 / FZD10 is a receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-10 / FZD10 may also be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.
References
TOP