Human Fragile histidine triad / FHIT Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGC901-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444bp
Gene Synonym
FRA3B, AP3Aase
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fragile histidine triad Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fragile histidine triad, also known as FHIT, may play a key role in differentiating humans from apes. Fragile histidine triad gene belongs to the histidine triad gene family. It has been shown that fragile histidine triad synergizes with VHL, another tumor suppressor, in protecting against chemically - induced lung cancer. Fragile histidine triad gene works as a tumor suppressor as it has been demonstrated in animal studies. The exact molecular function of FHIT is still partially unclear. It also acts as a tumor suppressor of HER2/neu driven breast cancer.
References
  • Lambert N, et al. (2006) An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 443(7108):167-72.
  • Pekarsky Y, et al. (1998) Nitrilase and Fhit homologs are encoded as fusion proteins in Drosophila melanogaster and Caenorhabditis elegans. Proc Natl Acad Sci. 95(15):8744-9.
  • Ohta M, et al. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell. 84(4): 587-97.
  • TOP