Human Fragile histidine triad / FHIT Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGC901-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444bp
Gene Synonym
FRA3B, AP3Aase
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fragile histidine triad Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fragile histidine triad, also known as FHIT, may play a key role in differentiating humans from apes. Fragile histidine triad gene belongs to the histidine triad gene family. It has been shown that fragile histidine triad synergizes with VHL, another tumor suppressor, in protecting against chemically - induced lung cancer. Fragile histidine triad gene works as a tumor suppressor as it has been demonstrated in animal studies. The exact molecular function of FHIT is still partially unclear. It also acts as a tumor suppressor of HER2/neu driven breast cancer.
References
  • Lambert N, et al. (2006) An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 443(7108):167-72.
  • Pekarsky Y, et al. (1998) Nitrilase and Fhit homologs are encoded as fusion proteins in Drosophila melanogaster and Caenorhabditis elegans. Proc Natl Acad Sci. 95(15):8744-9.
  • Ohta M, et al. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell. 84(4): 587-97.
  • TOP